Digitalizing the Clinical Research Informed Consent Process: Assessing the Participant Experience in Comparison With Traditional Paper-Based Methods.

PURPOSE: Consent processes are critical for clinical care and research and may benefit from incorporating digital strategies. We compared an electronic informed consent (eIC) option to paper consent across four outcomes: (1) technology burden, (2) protocol comprehension, (3) participant agency (ability to self-advocate), and (4) completion of required document fields. METHODS: We assessed participant experience with eIC processes compared with traditional paper-based consenting using surveys and compared completeness of required fields, over 3 years (2019-2021). Participants who consented to a clinical trial at a large academic cancer center via paper or eIC were invited to either pre-COVID-19 pandemic survey 1 (technology burden) or intrapandemic survey 2 (comprehension and agency). Consent document completeness was assessed via electronic health records. RESULTS: On survey 1, 83% of participants (n = 777) indicated eIC was easy or very easy to use; discomfort with technology overall was not correlated with discomfort using eIC. For survey 2, eIC (n = 262) and paper consenters (n = 193) had similar comprehension scores. All participants responded favorably to at least five of six agency statements; however, eIC generated a higher proportion of positive free-text comments (P < .05), with themes such as thoroughness of the discussion and consenter professionalism. eIC use yielded no completeness errors across 235 consents versus 6.4% for paper (P < .001). CONCLUSION: Our findings suggest that eIC when compared with paper (1) did not increase technology burden, (2) supported comparable comprehension, (3) upheld key elements of participant agency, and (4) increased completion of mandatory consent fields. The results support a broader call for organizations to offer eIC for clinical research discussions to enhance the overall participant experience and increase the completeness of the consent process.

Elemental Profiling of North-East Indian Tea (Camellia sinensis) by ICP-MS and Assessment of Associated Health Risk.

Tea is a perennial crop that requires acidic soil for better plant growth. Due to the acidic nature of tea-growing soil, metals can be easily absorbed by tea plants from growing medium. Other anthropogenic activities are also the major contributor of element in the tea. This study provided a comprehensive database of 24 elements which were analyzed by inductively coupled plasma mass spectrometry (ICP-MS). Selected 24 elements belong to alkali metal (Li, Rb, Cs), alkaline earth metal (Be, Sr, Ba), transition metal (V, Cr, Mn, Co, Ni, Cu, Zn, Ag, Cd, Hg), basic metal (Al, Ga, Sn, Tl, Pb), metalloid (As), non-metal (Se), and actinide (U). Total 321 drier mouth samples were collected during 2020-2021 from eight different regions (Darjeeling, Terai, Dooars, North Bank, Upper Assam, South Bank, Cachar, and Tripura) of north-east India. No inorganic mercury as well as uranium was detected in any tested tea samples. Mean concentrations of Be, As, Ga, Tl, Li, Se, Cd, Ag, Cs, V, Co, and Pb were at trace level, whereas macro-element mean concentrations were distributed in the manner of Al > Mn > Rb > Ba > Zn > Cu > Sr > Cr > Ni > Sn. Human health risk for non-carcinogenic and carcinogenic metals was also assessed for the studied elements. Hazard quotients (HQs) and hazard index (HI) values (< 1) for non-carcinogenic elements indicated no risk. The incremental lifetime cancer risk (ILCR) values for carcinogenic elements indicated no risk for As, Cd, and Pb and medium level risk for Ni. Study concluded that north-east Indian tea would not pose any health hazard.

Effects of different force fields on the structural character of α synuclein ß-hairpin peptide (35-56) in aqueous environment.

The hallmark of Parkinson's disease (PD) is the intracellular protein aggregation forming Lewy Bodies (LB) and Lewy neuritis which comprise mostly of a protein, alpha synuclein (α-syn). Molecular dynamics (MD) simulation methods can augment experimental techniques to understand misfolding and aggregation pathways with atomistic resolution. The quality of MD simulations for proteins and peptides depends greatly on the accuracy of empirical force fields. The aim of this work is to investigate the effects of different force fields on the structural character of ß hairpin fragment of α-syn (residues 35-56) peptide in aqueous solution. Six independent MD simulations are done in explicit solvent using, AMBER03, AMBER99SB, GROMOS96 43A1, GROMOS96 53A6, OPLS-AA, and CHARMM27 force fields with CMAP corrections. The performance of each force field is assessed from several structural parameters such as root mean square deviation (RMSD), root mean square fluctuation (RMSF), radius of gyration (Rg), solvent accessible surface area (SASA), formation of ß-turn, the stability of folded ß-hairpin structure, and the favourable conformations obtained for different force fields. In this study, CMAP correction of CHARMM27 force field is found to overestimate the helical conformation, while GROMOS96 53A6 is found to most successfully capture the conformational dynamics of α-syn ß-hairpin fragment as elicited from NMR.

Melting of polymeric DNA double helix at elevated temperature: a molecular dynamics approach.

Genomic DNA of higher organisms exists as extremely long polymers, while in bacteria and other lower organisms it is circular with no terminal base pairs. Temperature-induced melting of the DNA double helix by localized strand separation has been unattainable by molecular dynamic simulations due to more rapid fraying of the terminal base pairs in oligomeric DNA. However, local-sequence-dependent unfolding of the DNA double helix is extremely important for understanding various biochemical phenomena, and can be addressed by simulating a model polymeric DNA duplex. Here, we present simulations of polymeric B-DNA of sequence d(CGCGCGCGAATTCGCGCGCG)2 at elevated temperatures, along with its equivalent oligomeric constructs for comparison. Initiation of temperature-induced DNA melting was observed with higher fluctuations of the central d(AATT) region only in the model polymer. The polymeric construct shows a definite melting start site at the weaker A/T stretch, which propagates slowly through the CG rich regions. The melting is reflected in the hydrogen bond breaking, i.e. basepair opening, and by disruption of stacking interaction between successive basepairs. Melting at higher temperature of the oligomer, however, was only through terminal fraying, as also reported earlier.

The presence of non-native helical structure in the unfolding of a beta-sheet protein MPT63.

MPT63, a major secreted protein from Mycobacterium tuberculosis, has been shown to have immunogenic properties and has been implicated in virulence. MPT63 is a ß-sandwich protein containing 11 ß strands and a very short stretch of 310 helix. The detailed experimental and computational study reported here investigates the equilibrium unfolding transition of MPT63. It is shown that in spite of being a complete ß-sheet protein, MPT63 has a strong propensity toward helix structures in its early intermediates. Far UV-CD and FTIR spectra clearly suggest that the low-pH intermediate of MTP63 has enhanced helical content, while fluorescence correlation spectroscopy suggests a significant contraction. Molecular dynamics simulation complements the experimental results indicating that the unfolded state of MPT63 traverses through intermediate forms with increased helical characteristics. It is found that this early intermediate contains exposed hydrophobic surface, and is aggregation prone. Although MPT63 is a complete ß-sheet protein in its native form, the present findings suggest that the secondary structure preferences of the local interactions in early folding pathway may not always follow the native conformation. Furthermore, the Gly25Ala mutant supports the proposed hypothesis by increasing the non-native helical propensity of the protein structure.

Proteomic analysis of JAZ interacting proteins under methyl jasmonate treatment in finger millet.

Jasmonic acid (JA) signaling pathway in plants is activated against various developmental processes as well as biotic and abiotic stresses. The Jasmonate ZIM-domain (JAZ) protein family, the key regulator of plant JA signaling pathway, also participates in phytohormone crosstalk. This is the first study revealing the in vivo interactions of finger millet (Eleusine coracana (L.) Gaertn.) JAZ protein (EcJAZ) under methyl jasmonate (MJ) treatment. The aim of the study was to explore not only the JA signaling pathway but also the phytohormone signaling crosstalk of finger millet, a highly important future crop. From the MJ-treated finger millet seedlings, the EcJAZ interacting proteins were purified by affinity chromatography with the EcJAZ-matrix. Twenty-one proteins of varying functionalities were successfully identified by MALDI-TOF-TOF Mass spectrometry. Apart from the previously identified JAZ binding proteins, most prominently, EcJAZ was found to interact with transcription factors like NAC, GATA and also with Cold responsive protein (COR), etc. that might have extended the range of functionalities of JAZ proteins. Moreover, to evaluate the interactions of EcJAZ in the JA-co-receptor complex, we generated ten in-silico models containing the EcJAZ degron and the COI1-SKP1 of five monocot cereals viz., rice, wheat, maize, Sorghum and Setaria with JA-Ile or coronatine. Our results indicated that the EcJAZ protein of finger millet could act as the signaling hub for the JA and other phytohormone signaling pathways, in response to a diverse set of stressors and developmental cues to provide survival fitness to the plant.

Attenuation of the early events of α-synuclein aggregation: a fluorescence correlation spectroscopy and laser scanning microscopy study in the presence of surface-coated Fe3O4 nanoparticles.

The aggregation of α-synuclein (A-syn) has been implicated in the pathogenesis of Parkinson's disease (PD). Although the early events of aggregation and not the matured amyloid fibrils are believed to be responsible for the toxicity, it has been difficult to probe the formation of early oligomers experimentally. We studied the effect of Fe3O4 nanoparticle (NP) in the early stage of aggregation of A-syn using fluorescence correlation spectroscopy (FCS) and laser scanning microscopy. The binding between the monomeric protein and NPs was also studied using FCS at single-molecule resolution. Our data showed that the addition of bare Fe3O4 NPs accelerated the rate of early aggregation, and it did not bind the monomeric A-syn. In contrast, L-lysine (Lys)-coated Fe3O4 NPs showed strong binding with the monomeric A-syn, inhibiting the early events of aggregation. Lys-coated Fe3O4 NPs showed significantly less cell toxicity compared with bare Fe3O4 NPs and can be explored as a possible strategy to develop therapeutic application against PD. To the best of our knowledge, this report is the first example of using a small molecule to attenuate the early (and arguably the most relevant in terms of PD pathogenesis) events of A-syn aggregation.

Temperature effect on poly(dA).poly(dT): molecular dynamics simulation studies of polymeric and oligomeric constructs.

Understanding unwinding and melting of double helical DNA is very important to characterize role of DNA in replication, transcription, translation etc. Sequence dependent melting thermodynamics is used extensively for detecting promoter regions but melting studies are generally done for short oligonucleotides. This study reports several molecular dynamics (MD) simulations of homopolymeric poly(dA).poly(dT) as regular oligonucleotide fragments as well as its corresponding polymeric constructs with water and charge-neutralizing counterions at different temperatures ranging from 300 to 400 K. We have eliminated the end-effect or terminal peeling propensity by employing MD simulation of DNA oligonucleotides in such a manner that gives rise to properties of polymeric DNA of infinite length. The dynamic properties such as basepairing and stacking geometry, groove width, backbone conformational parameters, bending, distribution of counter ions and number of hydrogen bonds of oligomeric and polymeric constructs of poly(dA).poly(dT) have been analyzed. The oligomer shows terminal fraying or peeling effect at temperatures above 340 K. The polymer shows partial melting at elevated temperatures although complete denaturations of basepairs do not take place. The analysis of cross strand hydrogen bonds shows that the number of N-H···O hydrogen bonds increases with increase in temperature while C-H···O hydrogen bond frequencies decrease with temperature. Restructuring of counterions in the minor groove with temperature appear as initiation of melting in duplex structures.

Structural analysis of Ca²âº dependent and Ca²âº independent type II antifreeze proteins: a comparative molecular dynamics simulation study.

Comparative molecular dynamics simulations of Ca²âº dependent psychrophilic type II antifreeze protein (AFP) from herring (Clupea harengus) (hAFP) and Ca²âº dependent type II antifreeze protein from long snout poacher (Brachyopsis rostratus) (lpAFP) have been performed for 10 ns each at five different temperatures. We have tried to investigate whether the Ca²âº dependent protein obtains any advantage in nature over the independent one. To this end the dynamic properties of these two proteins have been compared in terms of secondary structure content, molecular flexibility, solvent accessibility, intra molecular hydrogen bonds and protein-solvent interactions. At 298 and 373 K the flexibility of the Ca²âº independent molecule is higher which indicates that Ca²âº could contribute to stabilize the structure. The thermal unfolding pathways of the two proteins have also been monitored. The rate of unfolding is similar up to 373 K, beyond that hAFP shows faster unfolding than lpAFP. The essential subspaces explored by the simulations of hAFP and lpAFP at different temperatures are significantly different as revealed from principal component analysis. Our results may help in understanding the role of Ca²âº for hAFP to express antifreeze activity. Furthermore our study may also help in elucidating the molecular basis of thermostability of two structurally similar proteins, which perform the same function in different manner, one in presence of Ca²âº, and the other in absence of the same.

Effect of temperature on DNA double helix: An insight from molecular dynamics simulation.

The three-dimensional structure of DNA contains various sequence-dependent structural information, which control many cellular processes in life, such as replication, transcription, DNA repair, etc. For the above functions, DNA double helices need to unwind or melt locally, which is different from terminal melting, as often seen in molecular dynamics (MD) simulations or even in many DNA crystal structures. We have carried out detailed MD simulations of DNA double helices of regular oligonucleotide fragments as well as in polymeric constructs with water and charge-neutralizing counter-ions at several different temperatures. We wanted to eliminate the end-effect or terminal melting propensity by employing MD simulation of DNA oligonucleotides in such a manner that gives rise to properties of polymeric DNA of infinite length. The polymeric construct is expected to allow us to see local melting at elevated temperatures. Comparative structural analysis of oligonucleotides and its corresponding virtual polymer at various temperatures ranging from 300 K to 400 K is discussed. The general behaviour, such as volume expansion coefficients of both the simulations show high similarity, indicating polymeric construct, does not give many artificial constraints. Local melting of a polymer, even at elevated temperature, may need a high nucleation energy that was not available in the short (7 ns) simulations. We expected to observe such nucleation followed by cooperative melting of the polymers in longer MD runs. Such simulations of different polymeric sequences would facilitate us to predict probable melting origins in a polymeric DNA.

Structural study of biologically significant ligands with major birch pollen allergen Betv1 by docking and molecular dynamics simulation.

The major birch pollen allergen, Betv1 of Betula verrucosa is the main causative agent of birch pollen allergy in humans. Betv1 is capable of binding several physiological ligands including fatty acids, flavones, cytokinins and sterols. Until now, no structural information from crystallography or NMR is available regarding binding mode of any of these ligands into the binding pocket of Betv1. In the present study thirteen ligands have been successfully docked into the hydrophobic cavity of Betv1 and binding free energies of the complexes have been calculated using AutoDock 3.0.5. A linear relationship with correlation coefficient (R²) of 0.6 is obtained between ΔG(b)s values plotted against their corresponding IC50 values. The complex formed between Betv1 and the best docking pose for each ligand has been optimized by molecular dynamics simulation. Here, we describe the ligand binding of Betv1, which provides insight into the biological function of this protein. This knowledge is required for structural alteration or inhibition of some of these ligands in order to modify the allergenic properties of this protein.

Structural study of carboxylesterase from hyperthermophilic bacteria Geobacillus stearothermophilus by molecular dynamics simulation.

Carboxylesterases are ubiquitous enzymes with important physiological, industrial and medical applications such as synthesis and hydrolysis of stereo specific compounds, including the metabolic processing of drugs, and antimicrobial agents. Here, we have performed molecular dynamics simulations of carboxylesterase from hyperthermophilic bacterium Geobacillus stearothermophilus (GsEst) for 10ns each at five different temperatures namely at 300K, 343K, 373K, 473K and 500K. Profiles of root mean square fluctuation (RMSF) identify thermostable and thermosensitive regions of GsEst. Unfolding of GsEst initiates at the thermosensitive alpha-helices and proceeds to the thermostable beta-sheets. Five ion-pairs have been identified as critical ion-pairs for thermostability and are maintained stably throughout the higher temperature simulations. A detailed investigation of the active site residues of this enzyme suggests that the geometry of this site is well preserved up to 373K. Furthermore, the hydrogen bonds between Asp188 and His218 of the active site are stably maintained at higher temperatures imparting stability of this site. Radial distribution functions (RDFs) show similar pattern of solvent ordering and water penetration around active site residues up to 373K. Principal component analysis suggests that the motion of the entire protein as well as the active site is similar at 300K, 343K and 373K. Our study may help to identify the factors responsible for thermostability of GsEst that may endeavor to design enzymes with enhanced thermostability.

Comparative structural studies of psychrophilic and mesophilic protein homologues by molecular dynamics simulation.

Comparative molecular dynamics simulations of psychrophilic type III antifreeze protein from the North-Atlantic ocean-pout Macrozoarces americanus and its corresponding mesophilic counterpart, the antifreeze-like domain of human sialic acid synthase, have been performed for 10 ns each at five different temperatures. Analyses of trajectories in terms of secondary structure content, solvent accessibility, intramolecular hydrogen bonds and protein-solvent interactions indicate distinct differences in these two proteins. The two proteins also follow dissimilar unfolding pathways. The overall flexibility calculated by the trace of the diagonalized covariance matrix displays similar flexibility of both the proteins near their growth temperatures. However at higher temperatures psychrophilic protein shows increased overall flexibility than its mesophilic counterpart. Principal component analysis also indicates that the essential subspaces explored by the simulations of two proteins at different temperatures are non-overlapping and they show significantly different directions of motion. However, there are significant overlaps within the trajectories and similar directions of motion of each protein especially at 298 K, 310 K and 373 K. Overall, the psychrophilic protein leads to increased conformational sampling of the phase space than its mesophilic counterpart. Our study may help in elucidating the molecular basis of thermostability of homologous proteins from two organisms living at different temperature conditions. Such an understanding is required for designing efficient proteins with characteristics for a particular application at desired working temperatures.

Temperature-induced unfolding pathway of a type III antifreeze protein: insight from molecular dynamics simulation.

Molecular dynamics simulations of the temperature-induced unfolding reaction of a cold-adapted type III antifreeze protein (AFPIII) from the Antarctic eelpout Lycodichthys dearborni have been carried out for 10 ns each at five different temperatures. While the overall character and order of events in the unfolding process are well conserved across temperatures, there are substantial differences in the timescales over which these events take place. Plots of backbone root mean square deviation (RMSD) against radius of gyration (Rg) serve as phase space trajectories. These plots also indicate that the protein unfolds without many detectable intermediates suggestive of two-state unfolding kinetics. The transition state structures are identified from essential dynamics, which utilizes a principal component analysis (PCA) on the atomic fluctuations throughout the simulation. Overall, the transition state resembles an expanded native state with the loss of the three 3(10) helices and disrupted C-terminal region. Our study provides insight into the structure-stability relationship of AFPIII, which may help to engineer AFPs with increased thermal stability that is more desirable than natural AFPs for some industrial and biomedical purposes.

Computational study of glyceraldehyde-3-phosphate dehydrogenase of Entamoeba histolytica: implications for structure-based drug design.

Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) of the pathogenic protozoa Entamoeba histolytica (Eh) is a major glycolytic enzyme and an attractive drug target since this parasite lacks a functional citric acid cycle and is dependent solely on glycolysis for its energy requirements. The three-dimensional structure of dimeric EhGAPDH in complex with cofactor NAD(+) has been generated by homology modeling based on the crystal structure of human liver GAPDH. Our refined model indicates the presence of a parasite specific disulfide bond between two cysteine residues of adjacent monomers in the EhGAPDH dimer, which may be an important target for future drug design. Flexible docking with the substrate glyceraldehyde-3-phosphate (G3P) shows that Cys151, His178, Thr210, and Arg233 are important residues in G3P binding. The inorganic phosphate-binding site of EhGAPDH has been determined by docking study. The binding mode of a natural GAPDH inhibitor, chalepin to EhGAPDH has also been predicted. In search for a better inhibitor for EhGADPH, in silico modification of chalepin has been carried out to form an additional specific polar interaction with Asp194 of EhGAPDH whose equivalent is Leu195 in human GAPDH. In the absence of a crystal structure, our study provides an early insight into the structure of major drug target EhGAPDH, thus, facilitating the inhibitor design.

Structural considerations for designing adenosine analogs as selective inhibitors of Trichomonas sp. glyceraldehyde-3- phosphate dehydrogenase.

Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) of pathogenic protozoa Trichomonas vaginalis (TvGAPDH) is an attractive drug target since this parasite lacks functional citric acid cycle and is dependent solely on glycolysis for its energy requirements. The three dimensional structure of TvGAPDH dimer has been generated by homology modelling based on the crystal structure of human liver GAPDH. Comparison of the NAD;{+} binding pocket of the modeled TvGAPDH with human GAPDH (hGAPDH) reveals the presence of a hydrophobic pocket near the N-6 position of adenine ring as well as a hydrophobic cleft near O-2' of the adenosine ribose that are absent in the human enzyme. In order to exploit these structural differences adenosine and several adenosine analogs with substitution on N-6 position of adenine ring or 2' position of ribose sugar or both have been studied by docking experiments using the program AutoDock version 3.0.5. Our docking result suggests that bulkier hydrophobic substitution at the N-6 position of the adenine ring could form more stable complexes with TvGAPDH than with hGAPDH. An improvement of binding occurs in TvGAPDH when methoxybenzamido group has been introduced at the O-2' position of the ribose sugar. The combination of N-6 and O-2' substitutions may have produced significantly improved inhibitors. Our study may help in identifying structural elements involved in the origin of selectivity at the NAD;{+} binding pocket of TvGAPDH. This study could further be extended for future anti-trichomonal drug design strategies in order to control trichomoniasis.